lilnyaa330p6ob2w lilnyaa330p6ob2w

04-04-2018
Biology

contestada

once rock reaches a depth of about _____, it may melt

Respuesta :

meg15010 meg15010

04-04-2018

The answer is 50km your wel

Answer Link

Rhino99howard Rhino99howard

11-12-2020

Answer:

50km

Explanation:

ap3x

Answer Link

Otras preguntas

List and briefly describe each of the five strength training principles. (Site 1)

One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob

You can calculate triangle area when you know all three sides by using Heron's Formula. You can also use a formula discovered by the Chinese which I found in W

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

ow many solutions does the equation 5m − 5m − 12 = 14 − 2 have? Zero One Two Many

Between 1920 and 1930, almost a million african american's left the south for the "promised land" up north during the

Describe why plant cells are rigid:

Suppose that a particular artillery piece has a range r = 5710 yards . find its range in miles. use the facts that 1mile=5280ft and 3ft=1yard

Please help!!!! URGENT!!!!!!!!!!!!!!!!!!!!!

Joan is 5 years older than ellen, and 3 years ago the sum of their ages was 17 years. in how many years will joan be 21 years old?