1lover152 1lover152
  • 03-01-2017
  • Chemistry
contestada

How do the orbits of a comet and earth compare?

Respuesta :

Linds630
Linds630 Linds630
  • 04-01-2017
Comets are balls of ice and dust in orbit around the Sun. The orbits of comets are different from those of planets - they are elliptical. A comet's orbit takes it very close to the Sun and then far away again.
Answer Link

Otras preguntas

True or False: The C major scale was the first scale discussed in the text. The G major scale sounds like the C major scale because both scales have the same i
Can you all help me out on this one please and thank you !
all known types of heterotrophs?
Why do the daylight hours change?
Devonshire, Inc. sold merchandise inventory on account at a price of $6,000 with payment terms of 2/10, n/30. The merchandise cost Devonshire $1,000. If the cus
What 3 things must occur for a reaction to successfully take place
The school office is now selling neon mechanical pencils. If the office pays $10.80 for a dozen pencils, how much should be charged to make a profit of 75 cents
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
Help Me!I don't understand !
Which text feature is intended to provide a brief description of what appears in a photo or drawing? font styles index charts & graphs captions