xrukiq44
xrukiq44 xrukiq44
  • 01-06-2021
  • English
contestada

Match the vocabulary word to its correct definition.

Match the vocabulary word to its correct definition class=

Respuesta :

shaikhaalzahmi11 shaikhaalzahmi11
  • 01-06-2021

Answer:

1,3,4,5,2

Explanation:

Answer Link
isthatchxppa
isthatchxppa isthatchxppa
  • 01-06-2021
1,3,4,5,2








jajahahahajahaha
Answer Link

Otras preguntas

If 2/3 + 6 = 7/6p, what is the value of p?
A relation is A. the output (y) values of the relation B. the input (x) values of the relation C. a set of points that pair input values with output values D. x
Explain the carbon cycle and explain why burning fossil fuels is an issue.
PLEASE HELP ASAP A diagonal length of a rhombus is multiplied by 2/3. Which of the following describes the effect of this change on the area?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a
What does President Lincoln express he did not want to do?
Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm
which ones are rational 1. 2.4 2. 74 3. 17.3333333… 4. π 5. 6. –18 7. 8. 87.125 9. –30 10. –8.3 11. 58.25 12. 121 13. 4.5 14.3 7/10
Solving this question