947bu9w3r7 947bu9w3r7
  • 02-11-2020
  • Mathematics
contestada

Which of the choices best describes this arithmetic sequence?
-2, 1, 4, 7, 10

Respuesta :

vvarrasso vvarrasso
  • 02-11-2020

Answer:

the best choice for the sequence is +3

Step-by-step explanation:

Answer Link
javchrisgonzalez
javchrisgonzalez javchrisgonzalez
  • 16-11-2020

A1 = -2

An = an-1 + 3

Answer Link

Otras preguntas

CAN SOMEONE PLEASE HELP ME
why did hamilton oppose term limits for certain government officials?
Can someone tell me the answer to this please this is mad confusing
You need to lightly when you are late so you wont wake up your parents. O tread O promote O draught O lair
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
A. Write an expression that represents the perimeter of the shape. Then evaluate your expression for x=6 and y=10 units. B. Write an expression that represents
What is the Rhyme Scheme of this poem? Jude's unicorn is cute. He's quite instrumental and plays the flute. He puckers and whistles to make the flute toot. Jud
¿Qué quiere decir: El fracaso es el exito en el progreso?
What event in the passage complicates the conflict Neto faces?
Write a paragraph that evaluates Odysseus’s qualifications as an epic hero. Select the link below to view the reading for reference. The Odyssey: from "Sea Per