ralexander6022 ralexander6022

01-10-2020
Mathematics

contestada

Given the midpoint and one of the endpaints, find the other endpoint of the segment (M is the midpoint) M(- 3, 7) and E(0, 2)

Respuesta :

crystaln2569 crystaln2569

01-10-2020

Sorry if this is wrong, but i’m pretty sure the answer is:

Answer: ( 10 , 17 )

Answer Link

Otras preguntas

Pete slid a domino off a bridge and it took 2.3 seconds to hit the Gully below how many feet did the domino fall

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The small organs used by spiders to produce silk are called _____________. silk nozzles spinnerets pedipalps mouthparts

The equation 2x2 + 5x - 12 = 0 is factored. Each factor is set equal to zero. What are these two equations?

Raquel recently received a poor grade on a school assignment. Her mother has noticed that Raquel is staying up late at night and hides in her room. Raquel is re

Why do you think James Meredith continued his march, even after he was shot?

Which correctly describes the reaction between potassium and excess water?

What does this passage suggest about truman's reasons for declaring his doctrine? he thinks the doctrine is necessary to protect the united states as well as ot

please help me if you can, thank you!

Solve for x and y: x-3y=-8 3x+2y=31