olivia4124 olivia4124

01-06-2020
Biology

contestada

What is one advantage of
convex mirrors for this use?

Respuesta :

yvescarmen46 yvescarmen46

02-06-2020

Answer:

It always gives a virtual, erect and a diminished image.

Hope this helps someone!!!

Answer Link

Otras preguntas

I really need help ASAP!!! I need to answer the question The question is “how might an engineer apply parts of the scientific method when conducting an investi

help me please someone. I will give brainliest.

-Describe three ways males could improve their status: 1- Knights: 2- Squires: 3- Apprenticeship:

assending order of 1/2,5/8,5/6 is

Sally makes dream catchers as a hobby and wants to sell them at craft shows. She knows that the fixed costs are $70 and the cost to produce each dream catcher i

The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Which solution is most likely isotonic? Which solution is most hypertonic? Which solution is most hypotonic?

how would the shift from normal to keto diet affect their RER? Please explain.

Is this a complete sentence? Unfortunately, our quarterback fumbled the ball in the fourth quarter.

what elements made up the compound carbon dioxide?