brownj8 brownj8
  • 05-05-2020
  • History
contestada

Which two developments did the compromise of 1850 bring about

Respuesta :

kcipriano473 kcipriano473
  • 05-05-2020

Answer:

freeing of runway slaves settled in the North. passage of a law to return escaped slaves to their owners. ban on slave trade in the nation's capital. Ban on slavery in Kansas and Nebraska

Answer Link

Otras preguntas

a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
who was the founder of Pennsylvania?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
a rectangle is 3 times as long as it is wide and its perimeter is 120 centimeters. find area.
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
what rule does static electricity follow
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are the 2 major types of cofactors?
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers