kcoo
kcoo kcoo
  • 04-08-2016
  • Mathematics
contestada

1.5 / 7.5 as a decimal

Respuesta :

sandersonjamie3
sandersonjamie3 sandersonjamie3
  • 04-08-2016
it is 0.2 if you are defining 
Answer Link
Juuzou101
Juuzou101 Juuzou101
  • 04-08-2016
0.2 would be the answer
Answer Link

Otras preguntas

Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _
The national competency-based credential for entry-level early childhood educators is called?
a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
a triangle has a measure of 30. The other two angles are in a ratio of 7:8. What are the measures of those two angles?
what value or values for x make the following inequality true? |x-3|=13 a)11 b)-10 c)-15 d)15
What are the points of discontinuity? Are they all removable? Please show your work.
(75) pointsPlease help me on these questions ASAP!!!
What is the elapsed time
A box contains 3 plain pencils and 5 pens. A second box contains 6 color pencils and 2 crayons. One item from each box is chosen at random. What is the probabil