mattilynnsmith mattilynnsmith
  • 01-04-2020
  • Mathematics
contestada

What is the slope of a line perpendicular to a line that contains the points (-3, 8) and (-3, -6)?

Select the best answer from the choices provided.

Respuesta :

TheAnimeGirl
TheAnimeGirl TheAnimeGirl
  • 01-04-2020

Hope this will help u.....

Ver imagen TheAnimeGirl
Answer Link

Otras preguntas

Which style of art is distinguished by texture oli paint ,solid forms suggested by shape imprecise lines ,and intermingled colors
the influence of Greek and Roman culture on some Renaissance art is reflected in what
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What nursing actions best promote communication when obtaining a nursing history? select all that apply?
An element's atomic number is 64. How many protons would an atom of this element have?
Check the area that applies to a mesomorph body type. select one: a. trim waist b. trouble losing weight c. stoop-shouldered d. short heavy legs
What man made object is likely to endure long after humans have disappeared from new york city?
Carl earned $6.20 per hour and worked 6 1/2 hours per day. What is the best estimate of his earning for a five-day work week?
zimmerman note definition
A mixture from which some of the particles settle out slowly upon standing