Aasthanarula Aasthanarula
  • 02-07-2016
  • English
contestada

examples explaining the proverb every cloud has a silver lining

Respuesta :

Hagrid
Hagrid Hagrid
  • 10-07-2016
The meaning of this idiom is that you should never feel hopeless when times get hard or difficult because difficult times always lead to better days. The difficult times are like dark clouds that blocks the sun. When we look at the edges of the cloud more closely, we can see the sun shining there like a silver lining.
Answer Link

Otras preguntas

In a probability experiment, Craig rolled a six-sided die 55 times. The die landed on a number greater than three 31 times. What is the ratio of rolls greater t
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are 2 points on the graph for 6x-5y=25
How has water influenced the development of civilization in Africa
a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
I want to work with LDAP. what is LDAP?
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
In which system of government would states function independently of each other?
Solve the equation -10 + 3x + 5x = -56 ? ??