amandanj2591 amandanj2591

01-12-2019
Mathematics

contestada

-6(y+5)-24=66 find the value of y

Respuesta :

Yang100 Yang100

02-12-2019

Answer:

y=-20

Step-by-step explanation:

-6(y+5)-24=66

-6y-30-24=66

-6y-54=66

-6y=66+54

-6y=120

y=120/-6=-20

Answer Link

Otras preguntas

how did white supremacists provide support for the ku klux klan

a club has 5 members. from these members, the positions of president and vice-president have to be filled. how many different ways can these 2 positions be fill

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If a family has three children, what is the probability that the family has at least one girl?

Which country is the world’s largest producer of wheat? USA China Russia France

The _______ was Franklin Roosevelt's program designed to fight the Great Depression

A relation is A. the output (y) values of the relation B. the input (x) values of the relation C. a set of points that pair input values with output values D. x

Find the area bounded by the curves x = y2 - 4y and x = 2y - y2. Your work must include an integral in one variable.

Help with geometry!!!

An important change in the american family in the nineteenth century was