doctobe
doctobe doctobe
  • 01-08-2019
  • Mathematics
contestada

How can this be possible? what should we add to make this true?

0 + 0 + 0 + 0 + 0 =120​

Respuesta :

kosala1478
kosala1478 kosala1478
  • 01-08-2019

Answer:

add 2 infront of the zeros

Step-by-step explanation:

20+20+20+20+20=120

or just adda 120 since 0+0+0+0+0+120=120

Answer Link
kobyhorne83
kobyhorne83 kobyhorne83
  • 01-08-2019
the answer is 120+0+0+0+0
Answer Link

Otras preguntas

please answer this im dying here
Find the probability that 4 students chosen at random are all born on a Wednesday. A) 1/28 B) 1/2401 C) 4/2401 D) 1/254
BC is parallel to DE What is AC? Enter your answer in the box.
cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left
Why did some americans feel that the united states should help europe after world war ii?
Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the
Write each statement as an algebraic expression. The product of two numbers, p and q, decreased by three times their sum.
Secured it means a lender gives you money in exchange for what?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Exercise has numerous health benefits. It conditions your heart and lungs and helps your body fight disease. Many people believe that exercise can help you look