moxoccamy moxoccamy
  • 03-08-2018
  • Computers and Technology
contestada

Why do the holes at the top of parachutes make it go slower

Respuesta :

pmm9228pcrtkr
pmm9228pcrtkr pmm9228pcrtkr
  • 03-08-2018
The more air resistance they encounter, the slower they fall. Eventually an equilibrium is reached between the downward acceleration caused by gravity and the upward push caused by air resistance. All because of the drag of the parachute.
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
Do all your pet's offspring look the same? If no, then explain why they look different.
what is the most common type of vegetation throughout Latin America
4.2meters= how many centimeter
Gina rented shoes, bowled 3 games, and bought 1 order of nachos. she used a coupon for 1/2 off the price of her bowling games. What was Ginas total cost before
does radiation need a phase of matter to travel with?
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
What are some methods used by Mussolini to rise to power?
What kind of problems did increased urbanization cause? During time of industrial revolution